Details

Genus:

Ctenopharyngodon

Species:

idella

Common Name:

grass carp

Genbank Taxid:

Group:

Fish

Habitat:

freshwater/brackish

Status:

invasive

Gene Region:

CYTB

Fragment Length:

61

qPCR Chemistry:

Probe

Forward Primer:

CAACGACGCGCTAGTCGAT

Reverse Primer:

TCCAAAGTTTCATCATGCAGAGA

Probe:

TTCCCACACCATCTAA

PCR Efficiency:

N/A

R2:

Limit of Detection:

0.015 copies/ΞΌl

Limit of Quantification:

N/A

Journal:

Molecular Ecology Resources