Green Sturgeon 0 comments Details Genus:Acipenser Species:medirostris Common Name:Green Sturgeon Genbank Taxid: Group:Fish Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:AGGGAAAAAATGGTTAGGTCTACAGA Reverse Primer:CCCCACTGGCGGGAAA Probe:CTCCCGCATGGGCTA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0153500 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
