Japanese anchovy 0 comments Details Engraulis japonicus Japanese anchovy Genus: Engraulis Species: japonicus Common Name: Japanese anchovy Genbank Taxid: 42892 Group: Fish Habitat: Marine Status: Gene Region: Cytb Fragment Length: 115 qPCR Chemistry: TaqMan Forward Primer: GAAAAACCCACCCCCTACTCA Reverse Primer: GTGGCCAAGCATAGTCCTAAAAG Probe: FAM–CGCAGTAGTAGACCTCCCAGCACCATCC–TAMRA PCR Efficiency: 0.90–0.95 R2: 1 Limit of Detection: – Limit of Quantification: – Journal: PLOS One Source: Takahashi et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.