Details

Engraulis japonicus Japanese anchovy

Genus:

Engraulis

Species:

japonicus

Common Name:

Japanese anchovy

Genbank Taxid:

42892

Group:

Fish

Habitat:

Marine

Status:

Gene Region:

Cytb

Fragment Length:

115

qPCR Chemistry:

TaqMan

Forward Primer:

GAAAAACCCACCCCCTACTCA

Reverse Primer:

GTGGCCAAGCATAGTCCTAAAAG

Probe:

FAM–CGCAGTAGTAGACCTCCCAGCACCATCC–TAMRA

PCR Efficiency:

0.90–0.95

R2:

1

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One