Japanese eel 0 comments Details Genus:Anguilla Species:japonica Common Name:Japanese eel Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:endangered/threatened Gene Region:16S Fragment Length:153 qPCR Chemistry:Probe Forward Primer:AATCAGTAATAAGAGGGCCCAAGC Reverse Primer:TGTTGGGTTAACGGTTTGTGGTA Probe:CACATGTGTAAGTCAGAACGGACCGACC PCR Efficiency:82.69%-95.91% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Aquatic Conservation: Marine and Freshwater Ecosystems Source: https://doi.org/10.1002/aqc.3058 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.