Details

Genus:

Trachurus

Species:

japonicus

Common Name:

Japanese jack mackerel

Genbank Taxid:

Group:

Fish

Habitat:

marine

Status:

Fishery

Gene Region:

CYTB

Fragment Length:

127

qPCR Chemistry:

Probe

Forward Primer:

CAGATATCGCAACCGCCTTT

Reverse Primer:

CCGATGTGAAGGTAAATGCAAA

Probe:

TATGCACGCCAACGGCGCCT

PCR Efficiency:

94.410 Β± 3.821

R2:

Limit of Detection:

N/A

Limit of Quantification:

N/A

Journal:

Ecology and Evolution