Japanese jack mackerel 0 comments Details Genus:Trachurus Species:japonicus Common Name:Japanese jack mackerel Genbank Taxid: Group:Fish Habitat:marine Status:Fishery Gene Region:CYTB Fragment Length:127 qPCR Chemistry:Probe Forward Primer:CAGATATCGCAACCGCCTTT Reverse Primer:CCGATGTGAAGGTAAATGCAAA Probe:TATGCACGCCAACGGCGCCT PCR Efficiency:94.410 ± 3.821 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Ecology and Evolution Source: https://doi.org/10.1002/ece3.4802 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.