Details

Trachurus japonicus Japanese jack mackerel

Genus:

Trachurus

Species:

japonicus

Common Name:

Japanese jack mackerel

Genbank Taxid:

83875

Group:

Fish

Habitat:

Marine

Status:

Gene Region:

Cytb

Fragment Length:

127

qPCR Chemistry:

TaqMan

Forward Primer:

CAGATATCGCAACCGCCTTT

Reverse Primer:

CCGATGTGAAGGTAAATGCAAA

Probe:

FAM–CCGTAGCACACATCTGCCGGGA–TAMRA

PCR Efficiency:

0.88–0.92

R2:

0.99–1

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One