Japanese sea nettle 0 comments Details Chrysaora pacifica Japanese sea nettle Genus: Chrysaora Species: pacifica Common Name: Japanese sea nettle Genbank Taxid: 1911418 Group: Cnidaria Habitat: Marine Status: Gene Region: COI Fragment Length: 231 qPCR Chemistry: TaqMan Forward Primer: CCCAGATATGGCTTTTCCTAGA Reverse Primer: TGAGTGAGCTTGTATAGCTGATA Probe: FAM–TAGGATCCTCCCTAATTG–NFQ–MGB PCR Efficiency: 0.90–0.93 R2: 0.9967 Limit of Detection: – Limit of Quantification: – Journal: PLOS One Source: Takahashi et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.