Details

Chrysaora pacifica Japanese sea nettle

Genus:

Chrysaora

Species:

pacifica

Common Name:

Japanese sea nettle

Genbank Taxid:

1911418

Group:

Cnidaria

Habitat:

Marine

Status:

Gene Region:

COI

Fragment Length:

231

qPCR Chemistry:

TaqMan

Forward Primer:

CCCAGATATGGCTTTTCCTAGA

Reverse Primer:

TGAGTGAGCTTGTATAGCTGATA

Probe:

FAM–TAGGATCCTCCCTAATTG–NFQ–MGB

PCR Efficiency:

0.90–0.93

R2:

0.9967

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One