Details

Clonophis kirtlandii Kirtland's Snake

Genus:

Clonophis

Species:

kirtlandii

Common Name:

Kirtland's Snake

Genbank Taxid:

183600

Group:

Reptile

Habitat:

Freshwater

Status:

Threatened

Gene Region:

COI

Fragment Length:

135

qPCR Chemistry:

TaqMan

Forward Primer:

TCCCCTTGTTCGTTTGGTCA

Reverse Primer:

CACCTCCGCATGGATCGAA

Probe:

ACCGACCGAAACATTAACACCTCCTT

PCR Efficiency:

80

R2:

0.899

Limit of Detection:

100

Limit of Quantification:

1000

Journal:

Animals