Kirtland’s Snake 0 comments Details Clonophis kirtlandii Kirtland's Snake Genus: Clonophis Species: kirtlandii Common Name: Kirtland's Snake Genbank Taxid: 183600 Group: Reptile Habitat: Freshwater Status: Threatened Gene Region: COI Fragment Length: 135 qPCR Chemistry: TaqMan Forward Primer: TCCCCTTGTTCGTTTGGTCA Reverse Primer: CACCTCCGCATGGATCGAA Probe: ACCGACCGAAACATTAACACCTCCTT PCR Efficiency: 80 R2: 0.899 Limit of Detection: 100 Limit of Quantification: 1000 Journal: Animals Source: Ratsch et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.