Details

Acipenser fulvescens Lake sturgeon

Genus:

Acipenser

Species:

fulvescens

Common Name:

Lake sturgeon

Genbank Taxid:

41871

Group:

Fish

Habitat:

Freshwater

Status:

Threatened

Gene Region:

Cytb

Fragment Length:

105

qPCR Chemistry:

TaqMan

Forward Primer:

ATGAATCGGAGGCCAACCAG

Reverse Primer:

TAAGCCTGTCAGAGGGAGGG

Probe:

VIC–CCTCCACAGTTTATTTTGCCCTATTCCT–MGBNFQ

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Conservation Genetics Resources