largetooth sawfish 0 comments Details Genus:Pristis Species:pristis Common Name:largetooth sawfish Genbank Taxid: Group:Fish Habitat:Freshwater Status:Thretened/Endangered Gene Region:COI Fragment Length:145 qPCR Chemistry:traditional Forward Primer:CCTCCTTCTACTAGCCTCTGCC Reverse Primer:GGA AGA GATA CCA GCT AAG TGC AACCTTCTACTAGCCTCTGCC Probe:CCTTCTACTAGCCTCTGCC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Endangered Species Research Source: https://www.nespmarine.edu.au/node/2577 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
