Details

Coregonus sardinella least cisco

Genus:

Coregonus

Species:

sardinella

Common Name:

least cisco

Genbank Taxid:

241494

Group:

Fish

Habitat:

Fresh/Brackishwater

Status:

Gene Region:

COI or cytb?

Fragment Length:

129

qPCR Chemistry:

TaqMan

Forward Primer:

CTCGCCCTCCTATTCTCTATCCTA

Reverse Primer:

GATGAGCATGTCTGCTACCAGG

Probe:

FAM‐CATTCTTCATACCTCTAAGCAG‐MGB‐NFQ

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Methods in Ecology and Evolution