Liver Fluke 0 comments Details Genus:Fasciola Species:hepatica Common Name:Liver Fluke Genbank Taxid: Group:parasite Habitat:other Status:Parasite Gene Region:ITS-2 Fragment Length:108 qPCR Chemistry:Probe Forward Primer:GGTTGGTACTCAGTTGTCA Reverse Primer:CAAAGTGACAGTGACGGAA Probe:CCTAGTCGGCACACTTATGATTTCTG PCR Efficiency:96 R2: Limit of Detection:14 ng Limit of Quantification:N/A Journal:Veterinary Parasitology Source: https://www.sciencedirect.com/science/article/pii/S0304401718302589?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
