Details

Procambarus virginalis Marbled Crayfish

Genus:

Procambarus

Species:

virginalis

Common Name:

Marbled Crayfish

Genbank Taxid:

2065263

Group:

Crusteacean

Habitat:

Freshwater

Status:

Invasive

Gene Region:

COI

Fragment Length:

189

qPCR Chemistry:

PCRBIO Ultra Mix Red

Forward Primer:

GTATAGTTGAGAGGGGAGTA

Reverse Primer:

CCATAGTTATACCAGCTGCC

Probe:

AGGTATTTTTTCCTTGCA

PCR Efficiency:

86.82

R2:

0.99

Limit of Detection:

1.656 pg / reaction at 37.36 ± 0.40 Ct

Limit of Quantification:

16.56 pg / reaction at 34.30 ± 0.44 Ct

Journal:

Management of Biological Invasions