Mekong giant catfish 0 comments Details Genus:Pangasianodon Species:gigas Common Name:Mekong giant catfish Genbank Taxid: Group:Fish Habitat:Freshwater Status:Threatened Gene Region:CYTB Fragment Length:83 qPCR Chemistry:Probe Forward Primer:CTAACCTGGATTGGTGGCAT Reverse Primer:AAGAAGAGGAAGTACAAGATGGAG Probe:(Pgigas_cytb_Pr: CCAATAATGATGAATGGATGTTCGACTGGC, PCR Efficiency:Not provided R2: Limit of Detection:5.10−8 ng of DNA/μL. Limit of Quantification:N/A Journal:Elsevier Source: http://dx.doi.org/10.1016/j.gecco.2016.06.007 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.