Moon Jellyfish 0 comments Details Aurelia aurita Moon Jellyfish Genus: Aurelia Species: aurita Common Name: Moon Jellyfish Genbank Taxid: 6145 Group: Cnidaria Habitat: Marine Status: Gene Region: COI Fragment Length: 120 qPCR Chemistry: TaqMan Forward Primer: TTACTACCCCCAGCTCTGCTTT Reverse Primer: TACTGAACCACCGGAATGG Probe: FAM–ATGAACAATTTATCCCCCCCTAAGCGCA–TAMRA PCR Efficiency: 0.90–0.95 R2: 0.98–1 Limit of Detection: – Limit of Quantification: – Journal: PLOS One Source: Takahashi et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.