Details

Aurelia aurita Moon Jellyfish

Genus:

Aurelia

Species:

aurita

Common Name:

Moon Jellyfish

Genbank Taxid:

6145

Group:

Cnidaria

Habitat:

Marine

Status:

Gene Region:

COI

Fragment Length:

120

qPCR Chemistry:

TaqMan

Forward Primer:

TTACTACCCCCAGCTCTGCTTT

Reverse Primer:

TACTGAACCACCGGAATGG

Probe:

FAM–ATGAACAATTTATCCCCCCCTAAGCGCA–TAMRA

PCR Efficiency:

0.90–0.95

R2:

0.98–1

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One