Details

Clarias gariepinus North African Sharptooth Catfish

Genus:

Clarias

Species:

gariepinus

Common Name:

North African Sharptooth Catfish

Genbank Taxid:

13013

Group:

Fish

Habitat:

Freshwater

Status:

Invasive

Gene Region:

COI

Fragment Length:

150

qPCR Chemistry:

MyTaq Red Mix

Forward Primer:

ACTCACAACCCAAATCGTTAAT

Reverse Primer:

5′–CAGGGCAGGCAAGACCTCCT–3′

Probe:

PCR Efficiency:

1

R2:

0.998

Limit of Detection:

Limit of Quantification:

Journal:

Molecular and Cellular Probes