North African Sharptooth Catfish 0 comments Details Clarias gariepinus North African Sharptooth Catfish Genus: Clarias Species: gariepinus Common Name: North African Sharptooth Catfish Genbank Taxid: 13013 Group: Fish Habitat: Freshwater Status: Invasive Gene Region: COI Fragment Length: 150 qPCR Chemistry: MyTaq Red Mix Forward Primer: ACTCACAACCCAAATCGTTAAT Reverse Primer: 5′–CAGGGCAGGCAAGACCTCCT–3′ Probe: – PCR Efficiency: 1 R2: 0.998 Limit of Detection: – Limit of Quantification: – Journal: Molecular and Cellular Probes Source: Elberri et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.