Details

Pacifastacus leniusculus Northamerican crayfish

Genus:

Pacifastacus

Species:

leniusculus

Common Name:

Northamerican crayfish

Genbank Taxid:

6720

Group:

Crusteacean

Habitat:

Freshwater

Status:

Invasive

Gene Region:

COI

Fragment Length:

65

qPCR Chemistry:

TaqMan

Forward Primer:

AACTAGAGGAATAGTTGAAAG

Reverse Primer:

CCGCTGCTAGAGGAGGATAA

Probe:

FAM‐AGGAGTGGGTACTGGATGAACT‐BHQ1

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Journal of Applied Ecology