Details

Genus:

Rana

Species:

aurora

Common Name:

Northern red-legged frog

Genbank Taxid:

Group:

Amphibian

Habitat:

freshwater

Status:

native

Gene Region:

CYTB

Fragment Length:

85

qPCR Chemistry:

Probe

Forward Primer:

CGGCTGACTCCTCCGTAATTTA

Reverse Primer:

ATAGAGGCCACGTCCGATGT

Probe:

ATGCTAACGGCGCATC

PCR Efficiency:

95โ€“109%

R2:

Limit of Detection:

N/A

Limit of Quantification:

N/A

Journal:

Northwestern Naturalist