Northern snakehead 0 comments Details Genus:Channa Species:argus Common Name:Northern snakehead Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:153 qPCR Chemistry:Probe Forward Primer:CGACCAGATTTATAATGTGGTCGTC Reverse Primer:CTTATGTTGTTCATTCGTGGGAAC Probe:ACTGGCTGGTTCCACTTA PCR Efficiency:92-104 R2: Limit of Detection:0.0003 ng Limit of Quantification:N/A Journal:Biological Invasions Source: https://link.springer.com/article/10.1007%2Fs10530-017-1532-z Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
