Northern two-lined salamander 0 comments Details Genus:Eurycea Species:bislineata Common Name:Northern two-lined salamander Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:72 qPCR Chemistry:Probe Forward Primer:CATAATTGGTGGGTTTGGTAACTG Reverse Primer:TTTATTCGTGGGAAG GCCATATCTGGTAACTG Probe:CTGCCACTAATAATTGGTGGTAACTG PCR Efficiency:84.96 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
