Pacific Chub Mackerel 0 comments Details Genus:Scomber Species:japonicus Common Name:Pacific Chub Mackerel Genbank Taxid: Group:Fish Habitat:Saltwater Status:Native Gene Region:COI Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GCTGAACAGTTTATCCTCCCCTCG Reverse Primer: Probe:TGGGAACCTGGCACACGCCGGG PCR Efficiency:92.7 R2: Limit of Detection:N/A Limit of Quantification:0.1 pg/μL Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0185043 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.