Pacific lamprey 0 comments Details Genus:Entosphenus Species:tridentatus Common Name:Pacific lamprey Genbank Taxid: Group:Fish Habitat:Saltwater Status:Endangered Gene Region:COI Fragment Length:126 qPCR Chemistry:Probe Forward Primer:TACCACTCATACTTAGTGCCCCTG Reverse Primer:CTGTGCCAGCCCCTGCT Probe:TTTGATTACTTCCACCCTCAC PCR Efficiency:97.2 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0169334 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
