Pacific Sardine 0 comments Details Genus:Sardinops Species:sagax Common Name:Pacific Sardine Genbank Taxid: Group:Fish Habitat:Marine Status:Native Gene Region:D-loop Fragment Length:107 qPCR Chemistry:Probe Forward Primer:TCAGAGCAAGGAAACTG Reverse Primer:CCGACGGTATACATAAAGC Probe:ATTTACCGGGTGCCCTTCATT PCR Efficiency:91 R2: Limit of Detection:N/A Limit of Quantification:0.1 pg/ul (36 cycles) Journal:Environmental Science and Technology Source: https://pubs.acs.org/doi/abs/10.1021/acs.est.6b03114 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
