platypus 0 comments Details Genus:Ornithorhynchus Species:anatinus Common Name:platypus Genbank Taxid: Group:Mammal Habitat:freshwater Status:endangered/threatened Gene Region:CR Fragment Length:57 qPCR Chemistry:Probe Forward Primer:CAGCAATACCCTAGACAAGG Reverse Primer:CGCTTCAATGGCTGCGC Probe:CGAACCCCATGAGTAGAAAAT PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Methods in Ecology and Evolution Source: https://doi.org/10.1111/2041-210X.12951 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.