Quagga mussel Details Genus:Dreissena Species:bugensis Common Name:Quagga mussel Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:164 qPCR Chemistry:Dye Forward Primer:GGGGTTGAACATTATAYCCACCGTT Reverse Primer:AAACTGATGACACCCGGCACG Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-013-9946-0 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast