Red–Eared Slider 0 comments Details Trachemys scripta elegans Red–Eared Slider Genus: Trachemys Species: scripta elegans Common Name: Red–Eared Slider Genbank Taxid: 31138 Group: Reptile Habitat: Fresh Status: Invasive Gene Region: 12S Fragment Length: 70 qPCR Chemistry: TaqMan Forward Primer: TCGCCAGCYTACCCYGT Reverse Primer: CCTTGACCTGACTTGTTAATGG Probe: GGATACAAAAGTAAGCAAG PCR Efficiency: 72.86 R2: 0.99 Limit of Detection: Limit of Quantification: Journal: Conservation Genetics Resources Source: Lam et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.