Details

Trachemys scripta elegans Red–Eared Slider

Genus:

Trachemys

Species:

scripta elegans

Common Name:

Red–Eared Slider

Genbank Taxid:

31138

Group:

Reptile

Habitat:

Fresh

Status:

Invasive

Gene Region:

12S

Fragment Length:

70

qPCR Chemistry:

TaqMan

Forward Primer:

TCGCCAGCYTACCCYGT

Reverse Primer:

CCTTGACCTGACTTGTTAATGG

Probe:

GGATACAAAAGTAAGCAAG

PCR Efficiency:

72.86

R2:

0.99

Limit of Detection:

Limit of Quantification:

Journal:

Conservation Genetics Resources