Details

Genus:

Perca

Species:

fluviatilis

Common Name:

redfin perch

Genbank Taxid:

Group:

Fish

Habitat:

Freshwater

Status:

Invasive

Gene Region:

12S

Fragment Length:

92

qPCR Chemistry:

Probe

Forward Primer:

GGGATTAGATACCCCACTATGCCT

Reverse Primer:

GGTTTCAAGCTGATGCTCGTAGTT

Probe:

(FAM)-CCATAAACATTGGTAGCACACT-(MGB)

PCR Efficiency:

N/A

R2:

Limit of Detection:

N/A

Limit of Quantification:

46.82 Β± 2.84

Journal:

Biol Invasions