redfin perch 0 comments Details Genus:Perca Species:fluviatilis Common Name:redfin perch Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:12S Fragment Length:92 qPCR Chemistry:Probe Forward Primer:GGGATTAGATACCCCACTATGCCT Reverse Primer:GGTTTCAAGCTGATGCTCGTAGTT Probe:(FAM)-CCATAAACATTGGTAGCACACT-(MGB) PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:46.82 Β± 2.84 Journal:Biol Invasions Source: https://doi.org/10.1007/s10530-016-1203-5 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.