Redside dace 0 comments Details Genus:Clinostomus Species:elongatus Common Name:Redside dace Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:104 qPCR Chemistry:Dye Forward Primer:TTGGCGCACCAGACATGGCA Reverse Primer:ACCGGCCTCAACGCCAGAAG Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-013-9946-0 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.