Details

Richardsonius balteatus redside shiner

Genus:

Richardsonius

Species:

balteatus

Common Name:

redside shiner

Genbank Taxid:

86930

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

COI

Fragment Length:

62

qPCR Chemistry:

TaqMan

Forward Primer:

5′–CTGGCTGCCGGAATTACAA–3′

Reverse Primer:

5′–GGGTCGAAGAATGTGGTGTTAA–3′

Probe:

6FAM–5′–ACTTCTCACAGACCGAAA–3′

PCR Efficiency:

R2:

Limit of Detection:

16.62 copies / reaction

Limit of Quantification:

45.34 copies / reaction

Journal:

BMC Research Notes