Details

Genus:

Ptychocheilus

Species:

grandis

Common Name:

Sacramento Pikeminnow

Genbank Taxid:

Group:

Fish

Habitat:

Brackish

Status:

Native

Gene Region:

COI

Fragment Length:

<150

qPCR Chemistry:

Probe

Forward Primer:

TCTTCGTATGGGCCGTACTTG

Reverse Primer:

GCCAGGACTGGTAGTGATAACAGA

Probe:

Probe-AACAGCCGTTCTTC

PCR Efficiency:

103

R2:

Limit of Detection:

0.64 pg/ΞΌL

Limit of Quantification:

N/A

Journal:

Molecular Ecology Resources