Details

Genus:

Parahucho

Species:

perryi

Common Name:

Sakhalin taimen

Genbank Taxid:

Group:

Fish

Habitat:

marine/brackish/freshwater

Status:

endangered/threatened

Gene Region:

ND2

Fragment Length:

124

qPCR Chemistry:

Probe

Forward Primer:

GCAATAGGCCTCCTATCAACAA

Reverse Primer:

CGAATTGTAAAATTAGTACTATCCATCCA

Probe:

AGCATACTCTTCAATCGCCCACCT

PCR Efficiency:

N/A

R2:

Limit of Detection:

0.95 copies 2 Ī¼lāˆ’1

Limit of Quantification:

N/A

Journal:

Limnology