sea lamprey 0 comments Details Genus:Petromyzon Species:marinus Common Name:sea lamprey Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:invasive Gene Region:COI Fragment Length:225 qPCR Chemistry:Conventional PCR Forward Primer:GGCAACTGACTTGTACCMCTAATACTTGGT Reverse Primer:GGCTAAGTGTAAGGAAAAGATTGTTAGGTCGAC Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:50 copies per reaction Limit of Quantification:N/A Journal:Journal of Great Lakes Research Source: https://doi.org/10.1016/j.jglr.2016.02.017 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
