Sea lamprey 0 comments Details Genus:Petromyzon Species:marinus Common Name:Sea lamprey Genbank Taxid: Group:Fish Habitat:freshwater Status:endangered/threatened Gene Region:COI Fragment Length:72 qPCR Chemistry:Probe Forward Primer:TTGGAGGCTTTGGCAACTG Reverse Primer:TGTTTATACGAGGGAAGGCCATA Probe:CTAATACTTGGTGCTCCTG PCR Efficiency:96 R2: Limit of Detection:0⋅1 pg μl-1 Cq=36 Limit of Quantification:N/A Journal:Journal of Fish Biology Source: http://doi.wiley.com/10.1111/jfb.12781 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
