Siberian sturgeon 0 comments Details Genus:Acipenser Species:baerii Common Name:Siberian sturgeon Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:CR Fragment Length:98 qPCR Chemistry:conventional PCR Forward Primer:GACAGTAATTGTAGAGTTTC Reverse Primer:CAGTAACAGGCTGATTATG Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0023398 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.