silver carp 0 comments Details Genus:Hypophthalmichthys Species:molitrix Common Name:silver carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:96 qPCR Chemistry:Probe Forward Primer:CGCAGGAGCATCCGTAGAC Reverse Primer:TTAATAGTTGTGGTGATGAAGTTAATTGC Probe:TTCTCTCTTCACCTAGCAG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Management of Biological Invasions Source: Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
