Silver Carp 0 comments Details Genus:Hypophthalmichthys Species:molitrix Common Name:Silver Carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:D-loop Fragment Length:100 qPCR Chemistry:Probe Forward Primer:GCGCAGAATGAACTATTACTTGCA Reverse Primer:GTA CTT TAA CCA GAT GCC AGA TAT AAT GTACAGAATGAACTATTACTTGCA Probe:59-6FAM-ATG TCC GTG AGA TTC CAA-MGB-NFQ-39CAGAATGAACTATTACTTGCA PCR Efficiency:averaged 100 R2: Limit of Detection:3 copies per reaction Limit of Quantification:30 copies per reaction Journal:PLOS ONE Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0114329 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
