Sockeye salmon 0 comments Details Genus:Oncorhynchus Species:nerka Common Name:Sockeye salmon Genbank Taxid: Group:Fish Habitat:Marine/freshwater Status:fisheries Gene Region:COI Fragment Length:152 qPCR Chemistry:Probe Forward Primer:GGAAACCTTGCCCACGCG Reverse Primer:AAAAGTGGGGTCTGGTACTGAG Probe:CTCTGTTGACTTAACCATC PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Food Science Source: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1750-3841.2010.01752.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
