Details

Acipenser ruthenus Sterlet

Genus:

Acipenser

Species:

ruthenus

Common Name:

Sterlet

Genbank Taxid:

7906

Group:

Fish

Habitat:

Anadromous

Status:

Vulnerable

Gene Region:

16S

Fragment Length:

qPCR Chemistry:

TaqMan

Forward Primer:

5′–TCTACCGTCACCCAGGTCAT–3′

Reverse Primer:

5′–CGCCTGTTAAGGTTGTGTTCTTTT–3′

Probe:

5′–FAM–GAGAGGTACAGCTCTCTTG–MGB–Q500–3′

PCR Efficiency:

99.6

R2:

0.998

Limit of Detection:

206 copies/reaction

Limit of Quantification:

208 copies/reaction

Journal:

Conservation Genetics Resources