Sterlet 0 comments Details Acipenser ruthenus Sterlet Genus: Acipenser Species: ruthenus Common Name: Sterlet Genbank Taxid: 7906 Group: Fish Habitat: Anadromous Status: Vulnerable Gene Region: 16S Fragment Length: – qPCR Chemistry: TaqMan Forward Primer: 5′–TCTACCGTCACCCAGGTCAT–3′ Reverse Primer: 5′–CGCCTGTTAAGGTTGTGTTCTTTT–3′ Probe: 5′–FAM–GAGAGGTACAGCTCTCTTG–MGB–Q500–3′ PCR Efficiency: 99.6 R2: 0.998 Limit of Detection: 206 copies/reaction Limit of Quantification: 208 copies/reaction Journal: Conservation Genetics Resources Source: Schenekar et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
