Striped jack 0 comments Details Genus:Pseudocaranx Species:dentex Common Name:Striped jack Genbank Taxid: Group:Fish Habitat:marine/brackish Status:N/A Gene Region:CYTB Fragment Length:130 qPCR Chemistry:Probe Forward Primer:ACGCAGTTTTTATTCTGGC Reverse Primer:CTAGGAAGTATAGGGC Probe:CGTGGCTATCCTCACCTGAATCGGG PCR Efficiency:73%-98% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Fisheries Science Source: https://link.springer.com/article/10.1007/s12562-018-1282-6 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
