Details

Oplegnathus fasciatus Striped knifejaw

Genus:

Oplegnathus

Species:

fasciatus

Common Name:

Striped knifejaw

Genbank Taxid:

163134 

Group:

Fish

Habitat:

Marine

Status:

Gene Region:

COI

Fragment Length:

166

qPCR Chemistry:

TaqMan

Forward Primer:

GAAACTGACTCATCCCCCTCA

Reverse Primer:

CCTGCGAGAGGCGGAT

Probe:

FAM–TAACATGAGCTTTTGACTGCTCCCACCCTC–TAMRA

PCR Efficiency:

0.81–0.85

R2:

0.99–1

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One