Striped knifejaw 0 comments Details Oplegnathus fasciatus Striped knifejaw Genus: Oplegnathus Species: fasciatus Common Name: Striped knifejaw Genbank Taxid: 163134 Group: Fish Habitat: Marine Status: Gene Region: COI Fragment Length: 166 qPCR Chemistry: TaqMan Forward Primer: GAAACTGACTCATCCCCCTCA Reverse Primer: CCTGCGAGAGGCGGAT Probe: FAM–TAACATGAGCTTTTGACTGCTCCCACCCTC–TAMRA PCR Efficiency: 0.81–0.85 R2: 0.99–1 Limit of Detection: – Limit of Quantification: – Journal: PLOS One Source: Takahashi et al. 2020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.