Sturgeon chub 0 comments Details Genus:Macrhybopsis Species:gelida Common Name:Sturgeon chub Genbank Taxid: Group:Fish Habitat:freshwater Status:native but in decline Gene Region:CYTB Fragment Length:102 qPCR Chemistry:Probe Forward Primer:CCTATGACTTGAAGAAACATCGTTG Reverse Primer:CCCTCAATCTTCGGATTACAAGAC Probe:CCTCAGTTCTATACTTTGCACTAT PCR Efficiency:95.572 R2: Limit of Detection:2 copies per reaction Limit of Quantification:N/A Journal:Plos One Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0209601 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.