sweetfish 0 comments Details Genus:Plecoglossus Species:altivelis Common Name:sweetfish Genbank Taxid: Group:Fish Habitat:Freshwater Status:Economically Important Gene Region:CYTB Fragment Length:131 qPCR Chemistry:Probe Forward Primer:CCTAGTCTCCCTGGCTTTATTCTCT Reverse Primer:GTAGAATGGCGTAGGCGAAAA Probe:ACTTCACGGCAGCCAACCCCC PCR Efficiency:77.4–83.0 R2: Limit of Detection:one copy per reaction with eight replicates Limit of Quantification:N/A Journal:Freshwater Biology Source: https://doi.org/10.1111/fwb.12846 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
