Three-spined stickleback 0 comments Details Genus:Gasterosteus Species:aculeatus Common Name:Three-spined stickleback Genbank Taxid: Group:Fish Habitat:Marine Status:N/A Gene Region:CYTB Fragment Length:101 qPCR Chemistry:Probe Forward Primer:ACGCCACCTTAACACGTTTC Reverse Primer:AGAGCCTGTCTGGTGAAGGA Probe:CTGGTGCCACACTTGTTCAC PCR Efficiency:90-100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3430657/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
