Wels catFish 0 comments Details Genus:Silurus Species:glanis Common Name:Wels catFish Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:COI Fragment Length:239 qPCR Chemistry:Conventional PCR Forward Primer:GCAGGAACAGGATGAACCGT Reverse Primer:ATCGGCAGGGACAGGAGTAA Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal for Nature Conservation Source: https://doi.org/10.1016/j.jnc.2018.02.006 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.