Details

Genus:

Acipenser

Species:

transmontanus

Common Name:

White Sturgeon

Genbank Taxid:

Group:

Fish

Habitat:

Freshwater/Saltwater

Status:

Native

Gene Region:

CYTB

Fragment Length:

<150

qPCR Chemistry:

Probe

Forward Primer:

CCCCGTTTGCATGAATGTTT

Reverse Primer:

CGCCCACATCTGCCGAGAT

Probe:

ATTAGTCATCCGTAATTCA

PCR Efficiency:

101

R2:

Limit of Detection:

0.026 pg/Ī¼L

Limit of Quantification:

N/A

Journal:

Journal of Fish and Wildlife Management