Details

Genus:

Rana

Species:

sylvatica

Common Name:

wood frog

Genbank Taxid:

Group:

Amphibian

Habitat:

Freshwater

Status:

Native

Gene Region:

CYTB

Fragment Length:

115

qPCR Chemistry:

Dye

Forward Primer:

TCCTTCATCAAACAGGATCATCTA

Reverse Primer:

CCTAGTATAATGGTGAAGCCGAAT

Probe:

N/A

PCR Efficiency:

N/A

R2:

Limit of Detection:

1.83Γ—10^(βˆ’3) pg/ΞΌL

Limit of Quantification:

N/A

Journal:

Conservation Genetics Resources