Details

Halichoeres tenuispinnis Wrasse

Genus:

Halichoeres

Species:

tenuispinnis

Common Name:

Wrasse

Genbank Taxid:

217853

Group:

Fish

Habitat:

Marine

Status:

Gene Region:

Cytb

Fragment Length:

113

qPCR Chemistry:

TaqMan

Forward Primer:

CGCAGACGTTGTAGTCCTCACA

Reverse Primer:

GTGAGAAGACTAGGAATAGTATAAAGTAGATGATG

Probe:

FAM–CCGTACGTAATTATTGGCCAAATCGCG–TAMRA

PCR Efficiency:

0.94–0.95

R2:

0.99–1

Limit of Detection:

Limit of Quantification:

Journal:

PLOS One