Yangtze finless porpoise 0 comments Details Genus:Neophocaena Species:asiaeorientalis asiaeorientalis Common Name:Yangtze finless porpoise Genbank Taxid: Group:other Habitat:Freshwater Status:Thretened/Endangered Gene Region:CYTB Fragment Length:76 qPCR Chemistry:Dye Forward Primer:TTCGGCCCTTTAGCCAACTC Reverse Primer:GGCTGACCTCCGATTCATGT Probe:N/A PCR Efficiency:92 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Biology Source: https://conbio.onlinelibrary.wiley.com/doi/full/10.1111/cobi.12910 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
