Details

Dreissena polymorpha Zebra Mussel

Genus:

Dreissena

Species:

polymorpha

Common Name:

Zebra Mussel

Genbank Taxid:

45954

Group:

Mollusk

Habitat:

Freshwater

Status:

Invasive

Gene Region:

COI

Fragment Length:

136

qPCR Chemistry:

TaqMan

Forward Primer:

TGGGGCAGTAAGAAGAAAAAAATAA

Reverse Primer:

CATCGAGGTCGCAAACCG

Probe:

VIC–CCGTAGGGATAACAGC–MGBNFQ

PCR Efficiency:

84.36

R2:

0.9883

Limit of Detection:

Limit of Quantification:

Journal:

Management of Biological Invasions