Database

Filter


Text Search

Genus Common Name Gene Region Fragment Length Forward Primer Reverse Primer Probe PCR Efficiency
Acanthopagrus Blackhead seabream Cytb 129 CTGTCTGCCGTCCCCTACA TATGGCGGCTACGATAAAAGGA FAM–TCAGTTGACAACGCAACCCTAACCCG–TAMRA 0.79–0.87
Acipenser Sterlet 16S 5′–TCTACCGTCACCCAGGTCAT–3′ 5′–CGCCTGTTAAGGTTGTGTTCTTTT–3′ 5′–FAM–GAGAGGTACAGCTCTCTTG–MGB–Q500–3′ 99.6
Acipenser Lake sturgeon COI 57 ACCCGGTGCCCTGCTT GGCGTGGGCTGTAACGATA FAM–CGATGATCAGATCTAC–MGBNFQ
Acipenser Lake sturgeon Cytb 105 ATGAATCGGAGGCCAACCAG TAAGCCTGTCAGAGGGAGGG VIC–CCTCCACAGTTTATTTTGCCCTATTCCT–MGBNFQ
Alasmidonta Dwarf wedgemussel COI 277 CACACCCCTTTCAACCAACG GTTGGCTTTAAGACTTTTAATC TGGTCATCTCCTAACAACCTTCCAGG 0.965
Alburnoides Cytb 63 5`–GGGCGCCACCGTCAT–3′ 5′–TGAACAAGTATGTCTCCCATGTAAGG–3′ 6FAM–CGA ATC TCC TTT CAG CAG T–MGBNFQ 93
Ammocrypta Eastern sand darter COI 83 5′‐CTTGTTCGTGTGGGCTGTGTT‐3′ 5′‐GCAAGAACTGGGAGCGAAAG‐3′ 5′‐6FAM‐ATTACCGCTGTTCTTC‐3′ 92–113
Anguilla Japanese eel 16S 154 AATCAGTAATAAGAGGGCCCAAGC TGTTGGGTTAACGGTTTGTGGTA CACATGTGTAAGTCAGAACGGACCGACC 82.4 to 88.9
Aphanomyces ITS1 59 AAGGCTTGT GCTGGGATGTT CTTCTTGC GAAACCTTCTGCTA 6 – FAM – TTCGGGACGACCCMGBNFQ 99.33
Aphanomyces ITS 5′–AAGGCTTGTGCTGGGATGTT–3′ 5′–CTTCTTGCGAAACCTTCTGCTA–3′ 5′–6–FAM–TTCGGGACGACCC–MGBNFQ–3′
Aphanomyces ITS 58 AAGGCTTGTGCTGGGATGTT CTTCTTGCGAAACCTTCTGCTA FAM‐TTCGGGACGACCC‐MGBNFQ
Astacus European noble crayfish COI 65 GATTAGAGGAATAGTAGAGAG CTGATGCTAAAGGGGGATAA FAM‐AGGAGTAGGGACAGGATGAACT‐BHQ1
Aurelia Moon Jellyfish COI 120 TTACTACCCCCAGCTCTGCTTT TACTGAACCACCGGAATGG FAM–ATGAACAATTTATCCCCCCCTAAGCGCA–TAMRA 0.90–0.95
Austropotamobius White–clawed crayfish COI 96 5′–GGG TTA GTG GAG AGA GGG GT–3′ 5′–AAT CCC CAG ATC CAC AGA CG–3′ 5′–TCA GCT ATT GCC CAC GCA–3′ 95.22–98.04
Chelonia Green Sea Turtle Control Region (D–Loop) 488 CGG TCC CCA AAA CCG GAA TCC TAT GCA AGT AAA ACT ACC GTA TGC CAG GTT 85.8
Chelonia Green Sea Turtle Control Region (D–Loop) 253 GGC CCA CAT AAC TGA TAC CTG CCG A GTC TCG GAT TTA GGG GTT TG 105
Chrysaora Japanese sea nettle COI 231 CCCAGATATGGCTTTTCCTAGA TGAGTGAGCTTGTATAGCTGATA FAM–TAGGATCCTCCCTAATTG–NFQ–MGB 0.90–0.93
Clarias North African Sharptooth Catfish COI 150 ACTCACAACCCAAATCGTTAAT 5′–CAGGGCAGGCAAGACCTCCT–3′ 1
Clonophis Kirtland's Snake COI 135 TCCCCTTGTTCGTTTGGTCA CACCTCCGCATGGATCGAA ACCGACCGAAACATTAACACCTCCTT 80
Coregonus least cisco COI or cytb? 129 CTCGCCCTCCTATTCTCTATCCTA GATGAGCATGTCTGCTACCAGG FAM‐CATTCTTCATACCTCTAAGCAG‐MGB‐NFQ